Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328894

Morpholino Name: lhx9 MO1
Synonyms: lhx9 e1i1
Target mRNA: lhx9

Morpholino Type: splice blocking morpholino
Sequence: 5' GGGTACACACGGCTACTTACTGTTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AAACAGTAAGTAGCCGTGTGTACCC 3' ||||||||||||||||||||||||| 3' TTTGTCATTCATCGGCACACATGGG 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 10.0 Chr4:111139518..111139542 25/25 Antisense target lhx9
Publications
First: Fezf2 promotes neuronal differentiation through localised activation of Wnt/β-catenin signalling during forebrain development., Development 2014                              
Most recent:
View All Papers