Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17329143

Morpholino Name: dsel MO1
Synonyms:
mRNA Target: dsel

Morpholino Type: uncategorized morpholino
Sequence:
5' ATGGTCCATTAGGAGAATAGTCAGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' ACTGACTATTCTCCAAATGGACCAT 3' |||||||||||||| |||||||||| 3' TGACTGATAAGAGGATTACCTGGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold210343:1365081..1365105 25/25 Antisense off-target Xelaev16027253m
Scaffold23301:1707892..1707916 24/25 Antisense off-target Xelaev16030600m
Scaffold165627:586639..586663 21/25 unknown
Scaffold187321:5357482..5357506 21/25 unknown
tropicalis 7.1 scaffold_6:48211266..48211290 24/25 Antisense target dsel
Publications
First: Musculocontractural Ehlers-Danlos syndrome and neurocristopathies: dermatan sulfate is required for Xenopus neural crest cells to migrate and adhere to fibronectin., Dis Model Mech 2016                        
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556