Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17329144

Morpholino Name: dse MO1
Synonyms:
mRNA Target: dse

Morpholino Type: uncategorized morpholino
Sequence:
5' GCTCCCCGAGTGTGAGTCCTCATTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: Musculocontractural Ehlers-Danlos syndrome and neurocristopathies: dermatan sulfate is required for Xenopus neural crest cells to migrate and adhere to fibronectin., Dis Model Mech 2016                        
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.1


Major funding for Xenbase is provided by grant P41 HD064556