Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17329150

Morpholino Name: zic2 MO2
Synonyms:
mRNA Target: zic2

Morpholino Type: uncategorized morpholino
Sequence:
5' GACCAGCGTCTAGTAGCATGTCCGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25 25/25
genomic

MO
5' ACGGACATGCTATTAGACGCCGGCC 3' |||||||||||| ||||||| || | 3' TGCCTGTACGATGATCTGCGACCAG 5' 5' ACGGACATGCTACTAGACGCTGGTC 3' ||||||||||||||||||||||||| 3' TGCCTGTACGATGATCTGCGACCAG 5' 5' ACGGACATGCTACTAGACGCTGGTC 3' ||||||||||||||||||||||||| 3' TGCCTGTACGATGATCTGCGACCAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold115919:500766..500790 25/25 Antisense target zic2.L
Scaffold167628:26168..26192 25/25 Antisense target zic2.S
Scaffold102974:14885121..14885145 22/25 Sense off-target lrpprc.L
tropicalis 7.1 scaffold_2:65186174..65186198 22/25 Antisense target zic2
Publications
First: Neural transcription factors bias cleavage stage blastomeres to give rise to neural ectoderm., Genesis 2016                            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556