Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17329151

Morpholino Name: zic2 MO3
Synonyms:
mRNA Target: zic2

Morpholino Type: uncategorized morpholino
Sequence:
5' TGTCCGTGCGACTGTGCCCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 20/20 19/20
genomic

MO
5' TGGGCACAGTCGCACGGACA 3' |||||||||||||||||||| 3' ACCCGTGTCAGCGTGCCTGT 5' 5' TGGGCACAATCGCACGGACA 3' |||||||| ||||||||||| 3' ACCCGTGTCAGCGTGCCTGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:119860050..119860069 20/20 Antisense target zic2.L
chr2S:102332180..102332199 19/20 Antisense target zic2.S
tropicalis 10.0 Chr5:130256670..130256689 18/20 Antisense off-target amotl2
Chr10:50887561..50887580 16/20 Antisense off-target prkca
Chr10:50887561..50887580 16/20 Antisense off-target Xetrov107011935m.g
Chr10:50887561..50887580 16/20 Antisense off-target Xetrov107011936m.g
Publications
First: Maternal Xenopus Zic2 negatively regulates Nodal-related gene expression during anteroposterior patterning., Development 2005                
Most recent: Neural transcription factors bias cleavage stage blastomeres to give rise to neural ectoderm., Genesis 2016                            
View All Papers