Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17329511

Morpholino Name: nadk MO1
Synonyms:
mRNA Target: nadk

Morpholino Type:
Sequence:
5' ACACTTTGCCCTGGGATCTCTCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 23/25 25/25
genomic

MO
5' ATGGAGAGATCCCAGGGCAAAGTGT 3' ||||||||||||||||||||||||| 3' TACCTCTCTAGGGTCCCGTTTCACA 5' 5' ATGGAGAGACCCCAGGGCAAAGAGT 3' ||||||||| |||||||||||| || 3' TACCTCTCTAGGGTCCCGTTTCACA 5' 5' ATGGAGAGATCCCAGGGCAAAGTGT 3' ||||||||||||||||||||||||| 3' TACCTCTCTAGGGTCCCGTTTCACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold88892:255596-255620 25/25 Antisense target nadk.S
Scaffold47457:1331231-1331255 23/25 Antisense target nadk.L
Scaffold197913:264132-264156 22/25 Antisense off-target Xelaev16025127m
tropicalis 7.1 scaffold_7:84189738-84189762 25/25 Antisense target nadk
scaffold_2:19827601-19827625 21/25 Antisense off-target anos1
Publications
First: NAD kinase controls animal NADP biosynthesis and is modulated via evolutionarily divergent calmodulin-dependent mechanisms. [Proc Natl Acad Sci U S A 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556