Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17329521

Morpholino Name: nadk MO2
Synonyms:
mRNA Target: nadk

Morpholino Type: Splice Blocking(E1-I1)
Sequence:
5' CATTCCAAGTCATTCCACACCTGAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TTCAGGTGTGGAATGACTTGGAATG 3' ||||||||||||||||||||||||| 3' AAGTCCACACCTTACTGAACCTTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold218195:2096120-2096144 21/25 unknown
Scaffold31469:1114391-1114415 21/25 Antisense off-target Xelaev16042125m
Scaffold6590:1651848-1651872 21/25 unknown
Scaffold86070:1511858-1511882 21/25 Antisense off-target Xelaev16076292m
tropicalis 7.1 scaffold_7:84189564-84189588 25/25 Antisense target nadk
scaffold_2:64430273-64430297 21/25 unknown
scaffold_4:62095618-62095642 21/25 Antisense off-target sptbn2
Publications
First: NAD kinase controls animal NADP biosynthesis and is modulated via evolutionarily divergent calmodulin-dependent mechanisms. [Proc Natl Acad Sci U S A 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556