Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17329620

Morpholino Name: pkd1 MO2
Synonyms: Pkd1-sMO2
mRNA Target: pkd1

Morpholino Type: splice blocking morpholino
Sequence:
5' CAAATGAGAAGGTTCTTACTACATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CATGTAGTAAGAACCTTCTCATTTG 3' ||||||||||||||||||||||||| 3' GTACATCATTCTTGGAAGAGTAAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:108012837..108012861 25/25 Antisense target pkd1.L
chr5L:88298566..88298590 21/25 Antisense off-target syncrip.L
chr3L:2535009..2535033 21/25 unknown
chr3L:64468070..64468094 21/25 unknown
chr7S:34844923..34844947 21/25 unknown
chr8S:40398218..40398242 21/25 unknown
chr9_10L:8453362..8453386 21/25 unknown
tropicalis 10.0 Chr5:118944393..118944417 21/25 unknown
Publications
First: The polycystin complex mediates Wnt/Ca(2+) signalling., Nat Cell Biol 2016                
Most recent:
View All Papers