Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17329682

Morpholino Name: txn MO1
Synonyms: Trx1 MO1
mRNA Target: XB5909790 [provisional]

Morpholino Type: uncategorized morpholino
Sequence:
5' ATGTGTCGAACCATATTGGCGTTTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold138921:950517..950541 25/25 Antisense off-target Xelaev16011885m
Scaffold90041:4618312..4618336 21/25 Antisense off-target Xelaev16078021m
Publications
First: Enhancement of axonal regeneration by in vitro conditioning and its inhibition by cyclopentenone prostaglandins., J Cell Sci 2008                          
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556