Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17329682

Morpholino Name: txn MO1
Synonyms: Trx1 MO1
Target mRNA: XB5909790 [provisional]

Morpholino Type: uncategorized morpholino
Sequence: 5' ATGTGTCGAACCATATTGGCGTTTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:93499468..93499492 25/25 Antisense off-target XB5909790.S
chr1L:113685248..113685272 21/25 Antisense off-target LOC100037235
Publications
First: Enhancement of axonal regeneration by in vitro conditioning and its inhibition by cyclopentenone prostaglandins., J Cell Sci 2008                          
Most recent:
View All Papers