Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17329757

Morpholino Name: fmn1 MO2
Synonyms:
Target mRNA: fmn1

Morpholino Type: splice blocking morpholino
Sequence: 5' TCAGGCTGGATGATAGGAGACAAAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TTTTGTCTCCTATCATCCAGCCTGA 3' ||||||||||||||||||||||||| 3' AAAACAGAGGATAGTAGGTCGGACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:88107560..88107584 25/25 Antisense target fmn1.L
chr4L:106304902..106304926 21/25 unknown
chr6S:27596745..27596769 21/25 unknown
tropicalis 10.0 Chr3:137742990..137743014 22/25 Sense off-target pde4a
Chr3:137742990..137743014 22/25 Sense off-target Xetrov107026649m.g
Publications
First: Emergence of an Apical Epithelial Cell Surface In Vivo., Dev Cell 2016              
Most recent: RhoA regulates actin network dynamics during apical surface emergence in multiciliated epithelial cells., J Cell Sci 2017                  
View All Papers