Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18006095

Morpholino Name: tsc1 MO1
Synonyms: xTsc1-sMO
mRNA Target: tsc1

Morpholino Type: splice blocking morpholino
Sequence:
5' AACACCAAGATACCTCGTTGGGTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/24 22/24
genomic

MO
5' GACCCAAGCAGGTATCTTGGTGTT 3' ||||||| ||||||||||||||| 3' CTGGGTTGCTCCATAGAACCACAA 5' 5' GACCCAAGCAGGTATCTTGGTGTT 3' ||||||| ||||||||||||||| 3' CTGGGTTGCTCCATAGAACCACAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:7459211..7459234 22/24 Antisense target tsc1.L
chr8S:31620647..31620670 22/24 Antisense target tsc1.S
chr8S:3758364..3758387 20/24 Antisense off-target rab15.S
chr4S:96432430..96432453 20/24 unknown
Publications
First: MicroRNAs are critical regulators of tuberous sclerosis complex and mTORC1 activity in the size control of the Xenopus kidney., Proc Natl Acad Sci U S A 2014                                                            
Most recent:
View All Papers