Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18006240

Morpholino Name: pax6 MO2
Synonyms:
mRNA Target: pax6

Morpholino Type: uncategorized morpholino
Sequence:
5' CCAACATCTGCTGATCAACGCCTAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' CTAGGCGTTGATCATCAGATGTTGG 3' |||||||||||||| |||||||||| 3' GATCCGCAACTAGTCGTCTACAACC 5' 5' CTAGGCGTTGATCAGCAGATGTTGG 3' ||||||||||||||||||||||||| 3' GATCCGCAACTAGTCGTCTACAACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4S:9868931..9868955 25/25 Antisense target pax6.S
chr4L:13323560..13323584 24/25 Antisense target pax6.L
chr8L:19491819..19491843 22/25 Sense off-target cdk5rap2.L
chr2S:110060051..110060075 21/25 unknown
tropicalis 10.0 Chr8:38504563..38504587 22/25 Sense off-target cdk5rap2
Publications
First: Hedgehog-dependent E3-ligase Midline1 regulates ubiquitin-mediated proteasomal degradation of Pax6 during visual system development., Proc Natl Acad Sci U S A 2016                      
Most recent:
View All Papers