Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18006309

Morpholino Name: mcl1 MO1
Synonyms:
mRNA Target: mcl1

Morpholino Type: splice blocking morpholino
Sequence:
5' AGTAGAGTAAGCCATGCTCACCCGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ACGGGTGAGCATGGCTTACTCTACT 3' ||||||||||||||||||||||||| 3' TGCCCACTCGTACCGAATGAGATGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold156846:727172..727196 25/25 Antisense target mcl1.L
Publications
First: Tumor protein Tctp regulates axon development in the embryonic visual system., Development 2016                                    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556