Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18006331

Morpholino Name: bptf MO1
Synonyms:
mRNA Target: bptf

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' CCCTGCGACCCCTCATGCTTTAGCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold163806:4742989..4743013 25/25 Antisense off-target Xelaev16018346m
Publications
First: A PHD finger of NURF couples histone H3 lysine 4 trimethylation with chromatin remodelling., Nature 2006  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556