Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18018334

Morpholino Name: hace1 MO1
Synonyms: HACE1 MO
mRNA Target: hace1

Morpholino Type:
Sequence:
5' GAGTTGCTCCATTGCTCTCTCCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GATGGAGAGAGCAATGGAGCAACTC 3' ||||||||||||||||||||||||| 3' CTACCTCTCTCGTTACCTCGTTGAG 5' 5' GATGGAGAGAGCAATGGAGCAACTC 3' ||||||||||||||||||||||||| 3' CTACCTCTCTCGTTACCTCGTTGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold8630:3082088..3082112 25/25 Antisense target hace1.L
Scaffold46073:1983739..1983763 21/25 unknown
Scaffold61562:99469..99493 21/25 Antisense off-target actn2.S
tropicalis 7.1 scaffold_5:47500196..47500220 25/25 Antisense target hace1
scaffold_2:11055340..11055364 21/25 unknown
Publications
First: The E3 ubiquitin ligase Hace1 is required for early embryonic development in Xenopus laevis. [BMC Dev Biol 2016]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.0
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556