Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18018794

Morpholino Name: hace1 MO3
Synonyms: HACE1 MO2
mRNA Target: hace1

Morpholino Type: uncategorized morpholino
Sequence:
5' AGAGGCTCAGCAGTTCCTAAGCAGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ACTGCTTAGGAACTGCTGAGCCTCT 3' ||||||||||||||||||||||||| 3' TGACGAATCCTTGACGACTCGGAGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold8630:3082166..3082190 25/25 Antisense target hace1.L
Scaffold23165:4767395..4767419 21/25 Antisense off-target Xelaev16030281m
tropicalis 7.1 scaffold_8:10509501..10509525 21/25 unknown
Publications
First: The E3 ubiquitin ligase Hace1 is required for early embryonic development in Xenopus laevis., BMC Dev Biol 2016                      
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556