Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18018963

Morpholino Name: rac1 MO3
Synonyms:
mRNA Target: rac1

Morpholino Type: uncategorized morpholino
Sequence:
5' CCACACATTTAATGGCCTGCATGGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: The E3 ubiquitin ligase Hace1 is required for early embryonic development in Xenopus laevis., BMC Dev Biol 2016                      
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.1


Major funding for Xenbase is provided by grant P41 HD064556