Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18258382

Morpholino Name: stk3 MO3
Synonyms:
mRNA Target: stk3

Morpholino Type: translation blocking morpholino
Sequence:
5' CTAGCTTCCAATTACCCTAAAGACA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' TGTCTTTAGGGTAATTGGAAGCTAG 3' ||||||||||||||||||||||||| 3' ACAGAAATCCCATTAACCTTCGATC 5' 5' TGTCTTTAGGGTCATTGGAAGCTGT 3' |||||||||||| |||||||||| 3' ACAGAAATCCCATTAACCTTCGATC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6S:106398617..106398641 22/25 Antisense target stk3.S
chr6L:129966472..129966496 23/25 Antisense off-target LOC108719348 [provisional:stk3]
chr1L:149928752..149928776 21/25 Sense off-target slc7a4.L
chr4S:20168573..20168597 21/25 Sense off-target nell1.S
chr1S:139903345..139903369 21/25 unknown
chr4L:40764383..40764407 21/25 unknown
tropicalis 10.0 Chr6:128980248..128980272 25/25 Antisense target stk3
Chr3:46823432..46823456 22/25 Antisense off-target LOC108646152
Chr7:54352011..54352035 21/25 Sense off-target lrmda
Publications
First: The NIMA-like kinase Nek2 is a key switch balancing cilia biogenesis and resorption in the development of left-right asymmetry., Development 2015                                    
Most recent:
View All Papers