Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18258383

Morpholino Name: nek2 MO2
Synonyms:
mRNA Target: nek2

Morpholino Type: splice blocking morpholino
Sequence:
5' GCTTTCTGTTGGCTCTCATACCTTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' ATAGGTATGAGAGCCAACAGAAGGC 3' | |||||||||||||||||||| || 3' TTTCCATACTCTCGGTTGTCTTTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5S:17653960..17653984 23/25 Antisense target nek2.S
chr1L:114359053..114359077 21/25 unknown
chr5L:154481321..154481345 21/25 unknown
tropicalis 10.0 Chr5:14887804..14887828 25/25 Antisense off-target LOC100328980
Chr1:150639249..150639273 21/25 Antisense off-target scarf2
Chr9:24363040..24363064 21/25 Sense off-target umod.3
Chr3:78240281..78240305 21/25 unknown
Publications
First: The NIMA-like kinase Nek2 is a key switch balancing cilia biogenesis and resorption in the development of left-right asymmetry., Development 2015                                    
Most recent:
View All Papers