Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18258384

Morpholino Name: nek2 MO3
Synonyms: nek2 MO1
mRNA Target: nek2

Morpholino Type: splice blocking morpholino
Sequence:
5' GGCGTCTGGAATATACATGGAATTA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25
genomic

MO
5' TGCTTCCCTGTATATTCCAGATGCC 3' | |||| ||||||||||||| ||| 3' ATTAAGGTACATATAAGGTCTGCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5S:17655269..17655293 21/25 Antisense target nek2.S
tropicalis 10.0 Chr5:14889249..14889273 25/25 Antisense off-target LOC100328980
Chr6:135272744..135272768 21/25 Antisense off-target csmd3
Chr6:153180110..153180134 21/25 Sense off-target fam83h
Chr1:207197351..207197375 21/25 unknown
Chr2:1466006..1466030 21/25 unknown
Chr2:1466329..1466353 21/25 unknown
Publications
First: The NIMA-like kinase Nek2 is a key switch balancing cilia biogenesis and resorption in the development of left-right asymmetry., Development 2015                                    
Most recent:
View All Papers