Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18258813

Morpholino Name: lhx9 MO2
Synonyms:
mRNA Target: lhx9

Morpholino Type: translation blocking morpholino
Sequence:
5' TCTGCACCCCACAATTTCCATATAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' GTATATGGAAATTGTGGGGTGTAGA 3' ||||||||||||||||||||| ||| 3' CATATACCTTTAACACCCCACGTCT 5' 5' GTATATGGAAATTGTGGGGTGCAGA 3' ||||||||||||||||||||||||| 3' CATATACCTTTAACACCCCACGTCT 5' 5' GTATATGGAAATTGTGGGGTGCAGA 3' ||||||||||||||||||||||||| 3' CATATACCTTTAACACCCCACGTCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:102619899..102619923 25/25 Antisense target lhx9.L
chr4S:84085500..84085524 25/25 Antisense target lhx9.S
chr6L:132269124..132269148 21/25 Sense off-target Xelaev18032254m
chr6L:6802852..6802876 22/25 unknown
chr3L:120740306..120740330 21/25 unknown
chr3L:121062844..121062868 21/25 unknown
chr6S:48446703..48446727 21/25 unknown
chr7S:20569081..20569105 21/25 unknown
tropicalis 10.0 Chr4:111139342..111139366 24/25 Antisense target lhx9
Chr7:125280537..125280561 21/25 unknown
Publications
First: The Lhx9-integrin pathway is essential for positioning of the proepicardial organ., Development 2016                                      
Most recent:
View All Papers