Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18258814

Morpholino Name: lhx9 MO3
Synonyms: Lhx9.S splice-blocking (donor exon1)
mRNA Target: lhx9

Morpholino Type: splice blocking morpholino (E1-I1)
Sequence:
5' TGCCCAGACGCCAGACTTACAGTTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AAACTGTAAGTCTGGCGTCTGGGCA 3' ||||||||||||||||||||||||| 3' TTTGACATTCAGACCGCAGACCCGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4S:84085679..84085703 25/25 Antisense target lhx9.S
chr7S:21178643..21178667 22/25 Sense off-target ldb1.S
tropicalis 10.0 Chr7:31936721..31936745 22/25 Sense off-target ldb1
Publications
First: The Lhx9-integrin pathway is essential for positioning of the proepicardial organ., Development 2016                                      
Most recent:
View All Papers