Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18258815

Morpholino Name: lhx9 MO4
Synonyms: lhx9.L splice-blocking (donor exon1)
mRNA Target: lhx9

Morpholino Type: splice blocking morpholino (E1-I1)
Sequence:
5' CGCGGCTACTTACAGTTTCTCTGCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' GGCAGAGAAACAGTAAGTAGCCGTG 3' ||||||||||| ||||||||||| | 3' CCGTCTCTTTGACATTCATCGGCGC 5' 5' GGCAGAGAAACTGTAAGTAGCCGCG 3' ||||||||||||||||||||||||| 3' CCGTCTCTTTGACATTCATCGGCGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:102620071..102620095 25/25 Antisense target lhx9.L
chr2L:15131850..15131874 21/25 Sense off-target tiam1.L
chr5S:23370276..23370300 21/25 Antisense off-target fshr.S
tropicalis 10.0 Chr4:111139511..111139535 23/25 Antisense target lhx9
Chr1:174379898..174379922 23/25 Antisense off-target fbxl17
Chr10:12202424..12202448 21/25 unknown
Publications
First: The Lhx9-integrin pathway is essential for positioning of the proepicardial organ., Development 2016                                      
Most recent:
View All Papers