Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18259600

Morpholino Name: wdpcp MO1
Synonyms:
mRNA Target: wdpcp

Morpholino Type:
Sequence:
5' ACAGCTCAGTCAGACAAAACGACAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' ATGTCTTTTTGCCTGACTGAGCTGT 3' ||||| ||||| ||||||||||||| 3' TACAGCAAAACAGACTGACTCGACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold12020:6399073-6399097 25/25 Antisense off-target Xelaev16005313m
Scaffold11978:541304-541328 21/25 Antisense off-target mrpl16.S
tropicalis 7.1 scaffold_5:94169051-94169075 23/25 Antisense target wdpcp
scaffold_7820:2237-2261 22/25 unknown
scaffold_4:134675733-134675757 21/25 Antisense off-target ptprg
scaffold_4:56842572-56842596 21/25 unknown
Publications
First: The planar cell polarity effector protein Wdpcp (Fritz) controls epithelial cell cortex dynamics via septins and actomyosin. [Biochem Biophys Res Commun 2015]
Most recent: The ciliopathy-associated CPLANE proteins direct basal body recruitment of intraflagellar transport machinery. [Nat Genet 2016]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556