Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18260080

Morpholino Name: ccnb1.2 MO1
Synonyms: Cyclin B1-Beta
mRNA Target: ccnb1.2

Morpholino Type: uncategorized morpholino
Sequence:
5' ACATTTTCTCAAGCGCAAACCTGCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TGCAGGTTTGCGCTTGAGAAAATGT 3' ||||||||||||||||||||||||| 3' ACGTCCAAACGCGAACTCTTTTACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4S:67598823..67598847 25/25 Antisense target ccnb1.2.S
chr4S:57358199..57358223 21/25 Sense off-target LOC108715516 [provisional:lrrc7]
Publications
First: Changes in oscillatory dynamics in the cell cycle of early Xenopus laevis embryos., PLoS Biol 2014                
Most recent:
View All Papers