Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18319815

Morpholino Name: pa2g4 MO3
Synonyms: pa2g4 MO2
mRNA Target: pa2g4

Morpholino Type:
Sequence:
5' CCTGTGACAGCTCTTTCACCCCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 19/23
genomic

MO
5' CTGGGTGAAAGAGCTGTCGGAGG 3' |||||||||||||||| ||| 3' TCCCCACTTTCTCGACAGTGTCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold8129:7801239-7801261 23/23 Antisense off-target Xelaev16074775m
Scaffold14978:1851609-1851631 19/23 Antisense target pa2g4.L
Scaffold33059:20148-20170 19/23 Sense off-target Xelaev16043838m
tropicalis 7.1 scaffold_6:13810139-13810161 19/23 unknown
scaffold_8:93566148-93566170 19/23 Sense off-target inpp1
Publications
First: Pa2G4 is a novel Six1 co-factor that is required for neural crest and otic development. [Dev Biol 2017]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556