Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18319819

Morpholino Name: pa2g4 MO4
Synonyms: pa2g4 MO1
mRNA Target: pa2g4

Morpholino Type: Translation Blocking(ATG)
Sequence:
5' CTCCTGCTGTTCTTCGTCACCCGACAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 26/27 27/27
genomic

MO
5' ATGTCGGGGGACGAAGAACAGCAGGAG 3' |||||||| |||||||||||||||||| 3' TACAGCCCACTGCTTCTTGTCGTCCTC 5' 5' ATGTCGGGTGACGAAGAACAGCAGGAG 3' ||||||||||||||||||||||||||| 3' TACAGCCCACTGCTTCTTGTCGTCCTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold14978:1851640-1851666 27/27 Antisense target pa2g4.L
Scaffold8129:7801203-7801229 27/27 Antisense off-target Xelaev16074775m
tropicalis 7.1 scaffold_2:80946909-80946935 26/27 Antisense target pa2g4
scaffold_5445:2112-2138 23/27 unknown
scaffold_6:123722682-123722708 23/27 unknown
Publications
First: Pa2G4 is a novel Six1 co-factor that is required for neural crest and otic development. [Dev Biol 2017]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556