Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18328514

Morpholino Name: mapk8 MO2
Synonyms: AGCCGAAGCPAGCGTGACAG, JNK1, JNK1 photo MO
mRNA Target: mapk8

Morpholino Type: photo morpholino
Sequence:
5' CTGTCACGCTTGCTTCGGCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: Role of JNK during buccopharyngeal membrane perforation, the last step of embryonic mouth formation., Dev Dyn 2017              
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556