Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18328514

Morpholino Name: mapk8 MO2
Synonyms: AGCCGAAGCPAGCGTGACAG, JNK1, JNK1 photo MO
Target mRNA: mapk8

Morpholino Type: photo morpholino
Sequence: 5' CTGTCACGCTTGCTTCGGCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 20/20 20/20 20/20
genomic

MO
5' AGCCGAAGCAAGCGTGACAG 3' |||||||||||||||||||| 3' TCGGCTTCGTTCGCACTGTC 5' 5' AGCCGAAGCAAGCGTGACAG 3' |||||||||||||||||||| 3' TCGGCTTCGTTCGCACTGTC 5' 5' AGCCGAAGCAAGCGTGACAG 3' |||||||||||||||||||| 3' TCGGCTTCGTTCGCACTGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7L:56496420..56496439 20/20 Antisense target mapk8.L
chr7S:37392105..37392124 20/20 Antisense target mapk8.S
tropicalis 10.0 Chr7:61782923..61782942 20/20 Antisense target mapk8
Chr4:124230573..124230592 17/20 Sense off-target iars1
Publications
First: Role of JNK during buccopharyngeal membrane perforation, the last step of embryonic mouth formation., Dev Dyn 2017              
Most recent:
View All Papers