Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18328531

Morpholino Name: nodal5.4 MO1
Synonyms: xnr5
mRNA Target: nodal5.4

Morpholino Type:
Sequence:
5' TAAGTTACCTTTGCAATGAGGCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold220448:2094024..2094047 21/24 Sense off-target Xelaev16028625m
Scaffold17434:560632..560655 20/24 Sense off-target Xelaev16020839m
Scaffold278088:228689..228712 20/24 unknown
Scaffold29017:1029554..1029577 20/24 unknown
Scaffold56777:631326..631349 20/24 Antisense off-target Xelaev16062538m
Scaffold89475:805444..805467 20/24 Antisense off-target Xelaev16077791m
tropicalis 7.1 scaffold_9:98744108..98744131 20/24 Sense off-target tmprss3
Publications
First: Nodal signalling in Xenopus: the role of Xnr5 in left/right asymmetry and heart development. [Open Biol 2016]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556