Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18328533

Morpholino Name: rab11fip5 MO1
Synonyms:
mRNA Target: rab11fip5

Morpholino Type:
Sequence:
5' CGAAGAAACATGAGGACGAGCCTCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AGAGGCTCGTCCTCATGTTTCTTCG 3' ||||||||||||||||||||||||| 3' TCTCCGAGCAGGAGTACAAAGAAGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold27038:44420-44444 25/25 Antisense target rab11fip5.L
Publications
First: Regulation of distinct branches of the non-canonical Wnt-signaling network in Xenopus dorsal marginal zone explants. [BMC Biol 2016]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556