Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18328534

Morpholino Name: nog MO2
Synonyms:
mRNA Target: nog

Morpholino Type: Translation Blocking(5' UTR)
Sequence:
5' CACAAGGCACTGGGAATGATCCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' CATGGATCATTCCCAGTGCCTTGTG 3' ||||||||||||||||||||||||| 3' GTACCTAGTAAGGGTCACGGAACAC 5' 5' CATGGATCATTCCCAGTGCCTTGTG 3' ||||||||||||||||||||||||| 3' GTACCTAGTAAGGGTCACGGAACAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold100342:355662..355686 25/25 Antisense off-target Xelaev16000189m
Scaffold373158:1037649..1037673 25/25 Antisense target nog.L
Scaffold120511:1371331..1371355 22/25 unknown
Scaffold176467:90720..90744 21/25 Antisense off-target Xelaev16021335m
tropicalis 7.1 scaffold_10:15223218..15223242 25/25 Antisense target nog
Publications
First: Depletion of three BMP antagonists from Spemann''s organizer leads to a catastrophic loss of dorsal structures. [Dev Cell 2005]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556