Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18328534

Morpholino Name: nog MO2
Synonyms:
mRNA Target: nog

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence:
5' CACAAGGCACTGGGAATGATCCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' CATGGATCATTCCCAGTGCCTTGTG 3' ||||||||||||||||||||||||| 3' GTACCTAGTAAGGGTCACGGAACAC 5' 5' CATGGATCATTCCCAGTGCCTTGTG 3' ||||||||||||||||||||||||| 3' GTACCTAGTAAGGGTCACGGAACAC 5' 5' CATGGATCATTCCCAGTGCCTTGTG 3' ||||||||||||||||||||||||| 3' GTACCTAGTAAGGGTCACGGAACAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 Scaffold27:3458487..3458511 25/25 Antisense target nog.S
chr9_10L:27175770..27175794 25/25 Antisense target nog.L
chr3S:4114079..4114103 22/25 Antisense off-target large.S
Scaffold43:95324..95348 21/25 Antisense off-target Xelaev18003203m
tropicalis 10.0 Chr10:25898655..25898679 25/25 Antisense target nog
Publications
First: Depletion of three BMP antagonists from Spemann''s organizer leads to a catastrophic loss of dorsal structures., Dev Cell 2005                            
Most recent:
View All Papers