Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18328550

Morpholino Name: Tcf7 MO2
Synonyms: XTcf1 MO
mRNA Target: tcf7

Morpholino Type: splice blocking morpholino
Sequence:
5' GCCAGGGTCTGAGTATAGCAACATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' CATGTTGCTATACTCAGACCCTGGC 3' ||||||||||||||||||||||||| 3' GTACAACGATATGAGTCTGGGACCG 5' 5' CATGTTGCTATACTCAGACCCCGGC 3' ||||||||||||||||||||| ||| 3' GTACAACGATATGAGTCTGGGACCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:12623951..12623975 24/25 Antisense target tcf7.S
chr5S:117008406..117008430 21/25 unknown
tropicalis 10.0 Chr3:26602596..26602620 25/25 Antisense target tcf7
Chr4:138576523..138576547 21/25 Sense off-target tada3
Publications
First: Functional differences between Tcf1 isoforms in early Xenopus development., Int J Dev Biol 2017            
Most recent:
View All Papers