Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18328550

Morpholino Name: Tcf7 MO2
Synonyms: XTcf1 MO
mRNA Target: tcf7

Morpholino Type: splice blocking morpholino
Sequence:
5' GCCAGGGTCTGAGTATAGCAACATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CATGTTGCTATACTCAGACCCTGGC 3' ||||||||||||||||||||||||| 3' GTACAACGATATGAGTCTGGGACCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold17836:1545773..1545797 24/25 Antisense off-target Xelaev16021532m
Scaffold43061:6109576..6109600 21/25 unknown
tropicalis 7.1 scaffold_3:51662616..51662640 25/25 Antisense target tcf7
scaffold_4:123691247..123691271 21/25 Sense off-target tada3
Publications
First: Functional differences between Tcf1 isoforms in early Xenopus development., Int J Dev Biol 2017            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556