Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18328636

Morpholino Name: trhd MO2
Synonyms:
Target mRNA: trhd

Morpholino Type: uncategorized morpholino
Sequence: 5' TAGAGCCAGGAAGTATTCCCACCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGGTGGGAATACTTCCTGGCTCTA 3' ||||||||||||||||||||||||| 3' TACCACCCTTATGAAGGACCGAGAT 5' 5' ATGGTGGGAATACTTCCTGGCTCTA 3' ||||||||||||||||||||||||| 3' TACCACCCTTATGAAGGACCGAGAT 5' 5' ATGGTGGGAATACTTCCTGGCTCTA 3' ||||||||||||||||||||||||| 3' TACCACCCTTATGAAGGACCGAGAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:83151582..83151606 25/25 Antisense target trhd.L
chr9_10S:75434631..75434655 25/25 Antisense target trhd.S
chr9_10L:83151582..83151606 25/25 Antisense off-target Xelaev18045008m
chr1L:211855583..211855607 23/25 unknown
tropicalis 10.0 Chr9:47913978..47914002 25/25 Antisense target trhd
Publications
First: Disruption of the dynamic sub-cellular localization of the Xenopus tumorhead protein causes embryonic lethality at the early gastrula transition., Differentiation 2007              
Most recent:
View All Papers