Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18328647

Morpholino Name: n4bp3 MO2
Synonyms:
mRNA Target: n4bp3

Morpholino Type: uncategorized morpholino
Sequence:
5' CACTGAAGGTCTGAGCAGCTGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 23/25 25/25
genomic

MO
5' ATGGCAGCTGCTCAAACCTTCAATT 3' |||||||||||||| ||||||| | 3' TACCGTCGACGAGTCTGGAAGTCAC 5' 5' ATGGCAGCTGCTCAGACCTTCAATT 3' |||||||||||||||||||||| | 3' TACCGTCGACGAGTCTGGAAGTCAC 5' 5' ATGGCAGCTGCTCAGACCTTCAGTG 3' ||||||||||||||||||||||||| 3' TACCGTCGACGAGTCTGGAAGTCAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:97428258..97428282 25/25 Antisense target n4bp3.S
chr3L:40648019..40648043 23/25 Antisense target n4bp3.L
tropicalis 10.0 Chr3:47790555..47790579 22/25 Antisense target n4bp3
Chr8:99759421..99759445 21/25 unknown
Publications
First: The Nedd4 binding protein 3 is required for anterior neural development in Xenopus laevis., Dev Biol 2017                              
Most recent:
View All Papers