Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18328650

Morpholino Name: rcsd1 MO
Synonyms: rcsd1_MO
mRNA Target: rcsd1

Morpholino Type: uncategorized morpholino
Sequence:
5' CCCCTCCATTTCCTTCCTGGCTTCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 23/25
genomic

MO
5' TGGAGCCAGGAAGGAAATGGAGGTA 3' || |||||||||||||||||||| 3' ACTTCGGTCCTTCCTTTACCTCCCC 5' 5' TGAAGCCAGGAAGGAAATGGAGGTA 3' ||||||||||||||||||||||| 3' ACTTCGGTCCTTCCTTTACCTCCCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold145916:1682729..1682753 23/25 unknown
Scaffold207208:1481266..1481290 23/25 Antisense target rcsd1.S
Scaffold16001:1916295..1916319 22/25 unknown
Scaffold136959:919139..919163 21/25 unknown
Scaffold169375:98..122 21/25 Antisense off-target Xelaev16020105m
Scaffold40738:474631..474655 21/25 Antisense off-target Xelaev16051823m
tropicalis 7.1 scaffold_2:146021808..146021832 22/25 Antisense target rcsd1
scaffold_2:17798375..17798399 22/25 unknown
scaffold_2:17926948..17926972 22/25 Antisense off-target sdf2
scaffold_2:144298306..144298330 21/25 unknown
scaffold_2:42115137..42115161 21/25 Antisense off-target loc100494383
scaffold_6:102539366..102539390 21/25 unknown
scaffold_6:105250880..105250904 21/25 unknown
scaffold_6:105710079..105710103 21/25 unknown
scaffold_6:106757177..106757201 21/25 unknown
scaffold_6:98553483..98553507 21/25 unknown
scaffold_7:37787652..37787676 21/25 unknown
scaffold_8:72594087..72594111 21/25 Sense off-target wdhd1
scaffold_9:29298962..29298986 21/25 unknown
Publications
First: The CapZ interacting protein Rcsd1 is required for cardiogenesis downstream of Wnt11a in Xenopus laevis., Dev Biol 2017                                    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556