Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18328652

Morpholino Name: rcsd1 MO3
Synonyms: rcsd1_MO3
mRNA Target: rcsd1

Morpholino Type: uncategorized morpholino
Sequence:
5' TGATATCCGCTGATTTCCCCTCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' TTGCAGGGGAAATCAGCGGATATCA 3' || ||||||||||||||||||||| 3' TACCTCCCCTTTAGTCGCCTATAGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold207208:1498342..1498366 23/25 Antisense target rcsd1.S
Scaffold9994:6235758..6235782 21/25 Antisense off-target Xelaev16081410m
Publications
First: The CapZ interacting protein Rcsd1 is required for cardiogenesis downstream of Wnt11a in Xenopus laevis., Dev Biol 2017                                    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556