Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18330991

Morpholino Name: XPhyH like MO1
Synonyms: Xelaev18038696m
mRNA Target: loc100490918

Morpholino Type: Translation Blocking(ATG)
Sequence:
5' TCATGGTTCAGAGAGTGGATTTTCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' AGAAAATCCACTCCATAAACCATGA 3' ||||||||||||| | |||||||| 3' TCTTTTAGGTGAGAGACTTGGTACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold36991:68759-68783 24/25 Antisense off-target Xelaev16048038m
Scaffold7546:39849-39873 23/25 Antisense off-target Xelaev16072218m
Scaffold94770:14482-14506 22/25 Antisense target loc100490918.L
Scaffold78860:8576228-8576252 21/25 Sense off-target Xelaev16073489m
Publications
First: Expression analysis of XPhyH-like during development and tail regeneration in Xenopus tadpoles: possible role of XPhyH-like expressing immune cells in impaired tail regenerative ability. [Biochem Biophys Res Commun 2013]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556