Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18334642

Morpholino Name: best2 MO1
Synonyms: xBest-2a MO
mRNA Target: best2

Morpholino Type: uncategorized morpholino
Sequence:
5' TCACATCAAGCTTTACCTGTATATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CATATACAGGTAAAGCTTGATGTGA 3' ||||||||||||||||||||||||| 3' GTATATGTCCATTTCGAACTACACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold55171:870776..870800 25/25 Antisense target best2.L
Scaffold121479:36989..37013 21/25 unknown
Scaffold169907:2964040..2964064 21/25 unknown
tropicalis 7.1 scaffold_10:188082..188106 21/25 unknown
scaffold_10:188138..188162 21/25 unknown
scaffold_10:188166..188190 21/25 unknown
scaffold_10:188306..188330 21/25 unknown
scaffold_10:188390..188414 21/25 unknown
Publications
First: Bestrophin genes are expressed in Xenopus development., Biochem Biophys Res Commun 2009                
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556