Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18334643

Morpholino Name: best2 MO2
Synonyms: xBest-2b MO
mRNA Target: best2

Morpholino Type: splice blocking morpholino
Sequence:
5' AGCTCCACTAAGAATTACCTGTATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CATACAGGTAATTCTTAGTGGAGCT 3' ||||||||||||||||||||||||| 3' GTATGTCCATTAAGAATCACCTCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold49557:306411..306435 25/25 Antisense target best2.S
Scaffold166674:4744912..4744936 21/25 unknown
Scaffold39723:7285999..7286023 21/25 unknown
Scaffold45452:835565..835589 21/25 Antisense off-target Xelaev16055119m
tropicalis 7.1 scaffold_6:51939883..51939907 22/25 unknown
scaffold_9:16114751..16114775 21/25 unknown
Publications
First: Bestrophin genes are expressed in Xenopus development., Biochem Biophys Res Commun 2009                
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556