Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18335931

Morpholino Name: ush1g MO1
Synonyms:
mRNA Target: ush1g

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' GTGATAGCGCCCGTCCATCCTGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGCAGGATGGACGGGCGCTATCAC 3' ||||||||||||||||||||||||| 3' TACGTCCTACCTGCCCGCGATAGTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold71264:1735428..1735452 24/25 Antisense off-target Xelaev16069922m
Scaffold195582:132537..132561 23/25 Sense off-target Xelaev16024703m
Scaffold318577:304477..304501 23/25 Antisense off-target Xelaev16042556m
tropicalis 7.1 scaffold_10:4945957..4945981 25/25 unknown
scaffold_10:4950027..4950051 25/25 Antisense target ush1g
Publications
First: Usher syndrome type 1-associated cadherins shape the photoreceptor outer segment., J Cell Biol 2017                    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556