Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18335932

Morpholino Name: ush1c MO1
Synonyms:
mRNA Target: ush1c

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' ACTCTCTGGCTATCTTCCTCTCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold47091:1816071..1816095 24/25 Antisense off-target Xelaev16056549m
Scaffold93786:119051..119075 24/25 unknown
Scaffold109184:1035410..1035434 21/25 Sense off-target Xelaev16002243m
Scaffold175714:1673070..1673094 21/25 unknown
tropicalis 7.1 scaffold_1:72582978..72583002 21/25 unknown
scaffold_32:789468..789492 21/25 unknown
scaffold_5:26858617..26858641 21/25 unknown
scaffold_8:25154309..25154333 21/25 unknown
Publications
First: Usher syndrome type 1-associated cadherins shape the photoreceptor outer segment., J Cell Biol 2017                    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556