Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18336942

Morpholino Name: vcan MO3
Synonyms: VsMO2
mRNA Target: vcan

Morpholino Type: uncategorized morpholino
Sequence:
5' GGGTCTTGACCTGAAATAAGACATT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' ATTGCCTTATTTCAGGTCAAGACCC 3' | || |||||||||||||||||||| 3' TTACAGAATAAAGTCCAGTTCTGGG 5' 5' AATGTCTTATTTCAGGTCAAGACCC 3' ||||||||||||||||||||||||| 3' TTACAGAATAAAGTCCAGTTCTGGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold1187:8494130..8494154 25/25 Antisense target vcan
Scaffold90265:1285286..1285310 21/25 unknown
tropicalis 7.1 scaffold_1:113671219..113671243 23/25 Antisense target vcan
scaffold_3:97990391..97990415 21/25 Antisense off-target c7orf58
Publications
First: In vivo confinement promotes collective migration of neural crest cells., J Cell Biol 2016                  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556