Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18338561

Morpholino Name: foxd1 MO1
Synonyms:
mRNA Target: foxd1

Morpholino Type: uncategorized morpholino
Sequence:
5' TCATGGCTTGGGAGGCAAAGCATAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' TTATGATTTGCCTCCCAAGCCATGA 3' ||||| ||||||||||||||||||| 3' AATACGAAACGGAGGGTTCGGTACT 5' 5' TTATGCTTTGCCTCCCAAGCCATGA 3' ||||||||||||||||||||||||| 3' AATACGAAACGGAGGGTTCGGTACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold1187:11159499..11159523 25/25 Antisense target foxd1
Scaffold32212:4427325..4427349 23/25 Antisense off-target Xelaev16042826m
Scaffold287959:1952962..1952986 21/25 unknown
tropicalis 7.1 scaffold_1:101954325..101954349 24/25 Antisense target foxd1
scaffold_1:120935265..120935289 21/25 Sense off-target hcn2
Publications
First: FoxD1 protein interacts with Wnt and BMP signaling to differentially pattern mesoderm and neural tissue., Int J Dev Biol 2017                
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556