Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18338692

Morpholino Name: nosip MO1
Synonyms:
mRNA Target: nosip

Morpholino Type: uncategorized morpholino
Sequence:
5' TACAGTTTTTCCCATGCCTTGTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGACAAGGCATGGGAAAAACTGTA 3' ||||||||||||||||||||||||| 3' TACTGTTCCGTACCCTTTTTGACAT 5' 5' ATGACAAGGCATGGGAAAAACTGTA 3' ||||||||||||||||||||||||| 3' TACTGTTCCGTACCCTTTTTGACAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold129797:712645..712669 25/25 Antisense target nosip
Scaffold29769:2031756..2031780 23/25 unknown
Scaffold125180:1497570..1497594 22/25 unknown
Scaffold12518:17630247..17630271 21/25 Sense off-target Xelaev16007519m
Scaffold155605:432143..432167 21/25 unknown
Scaffold172567:845..869 21/25 unknown
Scaffold291061:24808..24832 21/25 unknown
Scaffold293799:23..47 21/25 unknown
Scaffold3881:1897414..1897438 21/25 unknown
Scaffold51393:513207..513231 21/25 unknown
tropicalis 7.1 scaffold_2:101927814..101927838 25/25 Antisense target nosip
scaffold_7:21071235..21071259 22/25 unknown
scaffold_1:66444962..66444986 21/25 Antisense off-target cyb5r1
Publications
First: Developmental neurogenesis in mouse and Xenopus is impaired in the absence of Nosip., Dev Biol 2017                    
Most recent: Nosip functions during vertebrate eye and cranial cartilage development., Dev Dyn 2018                  
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556