Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18338692

Morpholino Name: nosip MO1
Synonyms:
mRNA Target: nosip

Morpholino Type: uncategorized morpholino
Sequence:
5' TACAGTTTTTCCCATGCCTTGTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGACAAGGCATGGGAAAAACTGTA 3' ||||||||||||||||||||||||| 3' TACTGTTCCGTACCCTTTTTGACAT 5' 5' ATGACAAGGCATGGGAAAAACTGTA 3' ||||||||||||||||||||||||| 3' TACTGTTCCGTACCCTTTTTGACAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7S:77633176..77633200 25/25 Antisense target nosip.S
chr7L:105736069..105736093 23/25 unknown
chr8S:71602059..71602083 22/25 unknown
Scaffold23:3016786..3016810 21/25 unknown
Scaffold59:646861..646885 21/25 unknown
Scaffold6287:845..869 21/25 unknown
chr2S:21926273..21926297 21/25 Sense off-target erg.S
chr3L:67930174..67930198 21/25 Sense off-target atxn7l1.L
chr4S:28118203..28118227 21/25 unknown
tropicalis 10.0 Chr7:110555930..110555954 25/25 Antisense target nosip
Chr3:123640014..123640038 22/25 unknown
Chr2:75172733..75172757 21/25 Antisense off-target cyb5r1
Publications
First: Developmental neurogenesis in mouse and Xenopus is impaired in the absence of Nosip., Dev Biol 2017                    
Most recent: Nosip functions during vertebrate eye and cranial cartilage development., Dev Dyn 2018                  
View All Papers