Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18338806

Morpholino Name: Ache MO1
Synonyms:
mRNA Target: ache

Morpholino Type:
Sequence:
5' CATGGCTGCTCCTCTGTGGGATTAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' GTAATCCCACAGAGGAGCGGCCATG 3' |||||||||||||||||| |||||| 3' CATTAGGGTGTCTCCTCGTCGGTAC 5' 5' GTAATCCCACAGAGGAGCAGCCATG 3' ||||||||||||||||||||||||| 3' CATTAGGGTGTCTCCTCGTCGGTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold175714:924535..924559 25/25 Antisense target ache
Scaffold402161:256315..256339 24/25 Antisense off-target Xelaev16051437m
Scaffold102974:13760336..13760360 21/25 unknown
Scaffold27036:1404608..1404632 21/25 unknown
tropicalis 7.1 scaffold_42:788015..788039 24/25 Antisense target ache
scaffold_5:4484176..4484200 21/25 unknown
Publications
First: Acetylcholinesterase plays a non-neuronal, non-esterase role in organogenesis. [Development 2017]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556