Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18338806

Morpholino Name: Ache MO1
Synonyms:
Target mRNA: ache

Morpholino Type: uncategorized morpholino
Sequence: 5' CATGGCTGCTCCTCTGTGGGATTAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genomic

MO
5' GTAATCCCACAGAGGAGCGGCCATG 3' |||||||||||||||||| |||||| 3' CATTAGGGTGTCTCCTCGTCGGTAC 5' 5' GTAATCCCACAGAGGAGCAGCCATG 3' ||||||||||||||||||||||||| 3' CATTAGGGTGTCTCCTCGTCGGTAC 5' 5' GTAATCCCACAGAGGAGTAGCCATG 3' ||||||||||||||||| ||||||| 3' CATTAGGGTGTCTCCTCGTCGGTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:134639429..134639453 25/25 Antisense target ache.L
Scaffold20:3170003..3170027 24/25 Antisense target ache.S
chr5L:8496860..8496884 21/25 Sense off-target haao.L
chr5L:8497021..8497045 21/25 Sense off-target haao.L
chr5L:8497107..8497131 21/25 Sense off-target haao.L
chr5L:8497178..8497202 21/25 Sense off-target haao.L
chr5L:8497224..8497248 21/25 Sense off-target haao.L
chr5L:8497270..8497294 21/25 Sense off-target haao.L
chr5L:8497316..8497340 21/25 Sense off-target haao.L
chr5L:8497359..8497383 21/25 Sense off-target haao.L
chr5S:20016219..20016243 21/25 unknown
tropicalis 10.0 Chr3:142510270..142510294 24/25 Antisense target ache
Chr5:106660302..106660326 21/25 unknown
Publications
First: Acetylcholinesterase plays a non-neuronal, non-esterase role in organogenesis., Development 2017                      
Most recent:
View All Papers