Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18338807

Morpholino Name: wbp2nl MO1
Synonyms:
mRNA Target: wbp2nl

Morpholino Type: Translation Blocking(5' UTR)
Sequence:
5' TCGCACTAAAGCCTTCAACTTCTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GGAGAAGTTGAAGGCTTTAGTGCGA 3' ||||||||||||||||||||||||| 3' CCTCTTCAACTTCCGAAATCACGCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold78978:2815412..2815436 25/25 Antisense target wbp2nl
Scaffold12423:2287443..2287467 22/25 Antisense off-target Xelaev16006557m
Scaffold12748:58..82 21/25 unknown
Scaffold262098:1796395..1796419 21/25 unknown
Scaffold360703:80467..80491 21/25 Sense off-target snip1-a
Publications
First: Wbp2nl has a developmental role in establishing neural and non-neural ectodermal fates. [Dev Biol 2017]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.8.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556