Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18338809

Morpholino Name: map2k1 MO1
Synonyms: Mk-MO ATG
mRNA Target: map2k1

Morpholino Type:
Sequence:
5' TGGGCGTAGGCTTCTTTTTAGGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGCCTAAGAAGAAGCCTACGCCCA 3' |||||||| |||||||||||||||| 3' TACGGATTTTTCTTCGGATGCGGGT 5' 5' ATGCCTAAAAAGAAGCCTACGCCCA 3' ||||||||||||||||||||||||| 3' TACGGATTTTTCTTCGGATGCGGGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold36401:3915795-3915819 25/25 Antisense off-target Xelaev16047549m
Scaffold58049:4605516-4605540 25/25 Antisense target map2k1
Scaffold159684:52-76 21/25 unknown
tropicalis 7.1 scaffold_3:32496117-32496141 24/25 Antisense target map2k1
scaffold_3:32496117-32496141 24/25 Sense off-target tipin
Publications
First: Lineage commitment of embryonic cells involves MEK1-dependent clearance of pluripotency regulator Ventx2. [Elife 2017]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556